Sampling Progress

As mentioned in the previous Lab Note, we have started to use qPCR to evalutate different sampling methods. We first developed qPCR primers using Primer Blast for Aurelia aurita (moon jellies, our currently available species). We targeted the COXI gene of the A. aurelia mitochondrial genome, which we obtained from NCBI GeneBank (accession number NC_008446.1:11908-13488). Primer Blast found several primer combinations, and we ordered the first two sets from GeneWiz. We tested both sets on DNA extracted from tissue, and DNA extracted from filters that had filtered aquarium water. The first primer set proved the more effective, so we adopted it as our qPCR primer set for A. aurita.

Forward primer: CCATGTTGGGGGACGATCAA Reverse primer: ATGGTCATACCAGGGGCTCT

Turning to the problem of sampling, we chose to start with dipstick sampling of water from the aquarium holding our moon jellies. The basic idea is to use DNA's affinity for cellulose to capture eDNA. We followed the protocols for dipstick sampling described in Mason, 2020 and Sanches, 2020, with modifications to allow for starting with passive samples instead of tissue or filters.

We prepared dipsticks (strips of Whatman #1 filter paper, dipped in wax (Gulfwax paraffin purchsed from the grocery store) leaving about 6mm exposed. We taped four of those dipsticks to a custom plastic frame and suspended the exposed dipstick ends in the moon jelly aquarium for one hour. We prepared four sets of lysis and wash buffer, according to the papers above, and after the aquarium soak, dipped each dipstick in a tube with 200ul lysis buffer, another tube with 100ul wash buffer, and finally in the qPCR tube that had been loaded with master mix, water and primers (separate tubes for each dipstick). One of the dipsticks (#2) broke off in the qPCR tube.

The qPCR results show that the tube with the broken dipstick did not amplify (as you might expect), and the other three did:

 

Figure 1. qPCR Results of Dipstick Sample Testing

If you aren't familar with qPCR, the chart shows the fluorescence of each tube as the PCR cycles progress. qPCR master mixes contain a dye that only fluoresces when it can bind with double stranded DNA (dsDNA). More fluorescence indicates amplification of the target as there is more dsDNA.

This is encouraging, as we would like to take advantage of passive sampling to simplify and streamline the sampling/lysis/extraction/purification process. At least initially it appears that dipsticks can consistently retain enough DNA to give a positive qPCR result.

Problems still to be explored:

• We still need to test with LAMP, as soon as we can develop reliable A. aurita LAMP primers. LAMP is generally more sensitive than qPCR and more tolerant of inhibitors.

• We need to try sampling for shorter times. An hour is a long time to ask a citizen scientist to wait for a sample.

• We need to try different dipstick configurations. Dipsticks need to be rugged enough to not break off in the reaction tube.

• It should be easy to create the dipsticks without dipping in hot wax, slitting, etc.

And of course, we need to test effectiveness of passive sampling in the open ocean, not just in an aquarium.

Encouraging results, but much work to do to reach our goal.